To get all news messages from us

Genome mapping using Eland

Short Solexa sequence reads are mapped to the human reference genome using Eland, the read-mapping program distributed by Illumina with its sequencing analysis pipeline. The output generated by Eland is a tab-delimited text file, with lines that look like:

>1-1-557-760	TCTTTTATAGCTCCAAACTTTTTTTTA	U0	1	0	0	2	63780267	R	..
>1-1-993-248	TTTTCTTTCTTTGTTTTTTTCTTCCTT	U0	1	3	153	12	24687605	R	..
>1-1-371-674	AATTTCTCTCTGCTGAAGCTCTTCTTA	U1	0	1	0	3	183334250	F	..	23G
>1-1-678-626	ACCCAGAATGCGCTGTTGATTTTTAGT	U1	0	1	0	8	70748333	F	..	27G
>1-1-174-418	TGTGTCCCTTTGTAATGAATCACTATC	U2	0	0	1	4	103570835	F	..	23G	24C
>1-1-105-657	TTCTAATTTGTATATTTGGACCATTTA	U1	0	1	2	12	100574279	R	..	2C

The columns from left to right are:

  1. Sequence name
  2. Sequence
  3. Type of match
  4. Number of exact matches found
  5. Number of 1-error matches found
  6. Number of 2-error matches found
    (For unique best match, U, only:)
  7. Genome file in which match was found (it indicates the chromosome number)
  8. Position of match
  9. Direction of match (F, forward; R, reverse)
  10. How N characters in read were interpreted (., not applicable; D, deletion; I, insertion)
    (For U1 and U2 matches only:)
  11. Position and type of the first substitution error
  12. Position and type of the second substitution error
See ELAND.html for details about using Eland for the whole genome alignment of Solexa reads and its output.

Allowed ELAND Formats

>1-1-201-448	GGATAATAGGCCTTTATCAGACATGTT	U0	1	2	1	Homo_sapiens.NCBI36.42.dna.chromosome.6.fa	150586572	F	..
>1-1-199-437	GGTTGCATTGGTGCAATTGTT		U1	0	1	3	Homo_sapiens.NCBI36.42.dna.chromosome.6.fa	50704915	F	..	19A
>1-1-94-309	GTTTATCCAATTTTGCTTTTAGTATCA	U0	1	0	0	Homo_sapiens.NCBI36.42.dna.chromosome.16.fa	45926410	R	..
>1-1-812-242	GTTATTGGTTATGGAGAGCTTATGTTA	U0	1	0	0	Homo_sapiens.NCBI36.42.dna.chromosome.10.fa	104455324	F	..
>1-1-835-525	GGTTTTCTGGAGCAAAATCTCTTGAGC	U0	1	0	0	Homo_sapiens.NCBI36.42.dna.chromosome.7.fa	25555335	R	..
>1-1-164-118	GATATGCATTGACTAACAGAAAACCAC	U0	1	0	0	Homo_sapiens.NCBI36.42.dna.chromosome.4.fa	116410190	F	..
>1-1-244-71	GATATTAAAGACACCTTATTATTTGGA	U0	1	0	0	Homo_sapiens.NCBI36.42.dna.chromosome.5.fa	16286199	F	..
>1-1-48-511	GCTGAATTCTTCGAAGTTAATTCTTTA	U0	1	0	0	Homo_sapiens.NCBI36.42.dna.chromosome.13.fa	95075033	F	..
>1-1-797-577	GTTATCAAAAGATAGATATCATTTCTG	U0	1	0	0	Homo_sapiens.NCBI36.42.dna.chromosome.1.fa	82693040	F	..

>@EAS38:4:1:910:511     GATTTTAATAATATATACATGCAATTGTGATAGAA     U0      1       0       0       chrom9.seq      51524546        R       ..
>@EAS38:4:1:879:548     GTTCTTAGCTCAGTATTATGATTATGATTAATTTT     U0      1       0       0       chrom16.seq     6647633 5       F       ..
>@EAS38:4:1:907:481     GAAAATGAGAAATACACACTTTAGGACGTGAAATA     R0      44      88      4
>@EAS38:4:1:907:524     GAAAATCATGGAAAATGAGAAACATCCACTTGACG     R0      67      43      28
>@EAS38:4:1:876:633     TGTATCTTTCCTGATCACTGCAGCCACGCACCTCA     U0      1       0       0       chrom1.seq      6909887 8       F       ..
>@EAS38:4:1:910:440     TTGTCAGTCGAACTTACTTTCTTCATTCAGTTACT     U0      1       0       0       chromX.seq      9057732 5       F       ..
>@EAS38:4:1:906:487     GGTGGTAATTCTACATCTGCTCTTTGTATATCCTT     U1      0       1       0       chrom6.seq      1197551 01      R       ..      4C
>@EAS38:4:1:896:455     TTTCAAAAGTTTTAAGTCTCCTTTTTATTTTTTAT     U0      1       0       0       chrom10.seq     3283482 6       R       ..
>@EAS38:4:1:911:401     GTGGACATTTCTAAATTTTACACCTTTTTCAGTTT     R1      0       41      54
>@EAS38:4:1:925:476     TTGTATTCCTTATTATACAGCCTTTGCTTGCTGTT     U0      1       0       5       chrom1.seq      1014029 99      R       ..
>@EAS38:4:1:895:400     GTTTGTTGAGGGATTACCTTCTTGTTTTTTCTAGT     R0      255     255     255
>@EAS38:4:1:663:636     GAAATTTTCAATTTTTTTCTTTTAATTTAGAATCT     U0      1       0       0       chrom11.seq     1102089 95      F       ..
>@EAS38:4:1:909:468     GCCCTGACTTCCTTTGATGATGAACAGTGATGTGT     R0      4       41      66
>@EAS38:4:1:899:821     GATGAATTTATAAATATAAATTTATAAAATTGAAA     U0      1       0       0       chrom18.seq     1295850 8       F       ..

>1-1-557-760	TCTTTTATAGCTCCAAACTTTTTTTTA	U0	1	0	0	2	63780267	R	..
>1-1-993-248	TTTTCTTTCTTTGTTTTTTTCTTCCTT	U0	1	3	153	12	24687605	R	..
>1-1-371-674	AATTTCTCTCTGCTGAAGCTCTTCTTA	U1	0	1	0	3	183334250	F	..	23G
>1-1-678-626	ACCCAGAATGCGCTGTTGATTTTTAGT	U1	0	1	0	8	70748333	F	..	27G
>1-1-174-418	TGTGTCCCTTTGTAATGAATCACTATC	U2	0	0	1	4	103570835	F	..	23G	24C
>1-1-105-657	TTCTAATTTGTATATTTGGACCATTTA	U1	0	1	2	12	100574279	R	..	2C

Last update January 2019